20% OFF shipping at stclaircommercialrealty.com on orders over $79 + up to 10% OFF products
stclaircommercialrealty.com
home > CD276 Recombinant Protein - NCP0197 > CD276 Recombinant Protein - NCP0197
download picture
CD276 Recombinant Protein - NCP0197CD276 Recombinant Protein Catalogue Number: NCP0197 500, NCP0197 1000 Sizes: 500ug, 1mg Swiss Prot: Q5ZPR3 Host: E. coli Tag: His tag AA Sequence:
Shopping security

Shopping security

Each payment you make on thelockerguy is secured with strict SSL encryption and PCI DSS data protection protocols

CD276 Recombinant Protein

Catalogue Number: NCP0197-500, NCP0197-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q5ZPR3

Host: E.coli

Tag: His-tag

AA Sequence: CTGGAAGTGCAGGTTCCGGAAGATCCGGTTGTTGCACTGGTTGGTACCGATGCAACCCTGTGTTGCAGCTTCAGTCCGGAACCGGGCTTCAGCCTGGCCCAGCTGAATCTGATCTGGCAGCTGACCGATACCAAACAGCTGGTTCATAGCTTCGCAGAAGGTCAGGATCAGGGCAGCGCATACGCTAATCGCACCGCCCTGTTCCCGGATCTGCTGGCACAGGGCAATGCCAGTCTGCGTCTGCAGCGCGTGCGCGTGGCCGATGAAGGCAGCTTCACCTGCTTCGTTAGCATTCGCGACTTCGGTAGTGCAGCAGTGAGCCTGCAGGTTGCCGCCCCGTATAGTAAACCGAGCATGACCCTGGAACCGAATAAAGATCTGCGTCCGGGCGATACCGTTACCATTACCTGCAGTAGTTATCAGGGTTATCCGGAAGCCGAAGTGTTCTGGCAGGATGGCCAGGGCGTTCCGCTGACCGGCAATGTTACCACCAGTCAGATGGCAAATGAACAGGGCCTGTTCGATGTTCATAGCATTCTGCGTGTGGTGCTGGGCGCAAATGGTACCTATAGTTGCCTGGTGCGTAATCCGGTGCTGCAGCAGGATGCACATAGCAGTGTGACCATTACCCCGCAGCGTAGTCCGACCGGCGCAGTTGAAGTGCAGGTGCCGGAAGATCCTGTGGTTGCCCTGGTTGGTACAGATGCAACCTTACGCTGCAGCTTCAGCCCGGAACCGGGCTTCAGTCTGGCCCAGTTAAATCTGATCTGGCAACTGACCGATACAAAACAGCTGGTGCATAGCTTCACCGAAGGTCGCGATCAGGGCTCAGCCTATGCCAATCGTACCGCCCTGTTCCCTGATCTGCTGGCGCAGGGCAATGCGAGTCTGCGTCTTCAGCGCGTGCGTGTGGCAGATGAAGGTAGCTTCACCTGCTTCGTGAGTATTCGCGACTTCGGCAGTGCAGCCGTTAGTCTGCAGGTGGCAGCACCGTATAGCAAACCGAGTATGACCCTGGAGCCGAATAAAGACCTGCGCCCGGGCGATACAGTGACCATTACATGCAGCAGTTATCGCGGCTATCCGGAAGCGGAAGTGTTCTGGCAAGATGGCCAGGGTGTGCCGCTGACCGGTAATGTTACCACAAGTCAGATGGCCAATGAACAGGGTCTGTTCGATGTGCATAGTGTTCTGCGTGTGGTTCTGGGCGCCAATGGTACCTACAGCTGCCTGGTGCGCAATCCGGTTCTGCAGCAGGACGCCCATGGTAGTGTTACCATTACAGGTCAGCCGATGACCTTCCCGCCGGAAGCC

Restriction Sites: NdeI-XhoI

Background: B7 homolog 3 (B7-H3, CD276) is a member of the B7 family of cell surface ligands that regulate T cell activation and immune responses. B7-H3 protein contains two extracellular Ig-like V-type domains and two IgG-like C2-type domains, a transmembrane domain, and a short intracellular domain. Early research examining the biological process of B7-H3 suggested that B7-H3 is a positive regulator of T cell response. Subsequent research studies indicated that B7-H3 is a negative regulator of T cell response, and that the protein inhibits T cell proliferation. One possibility is that B7-H3 interacts with two distinct sets of receptors, resulting in seemingly opposite biological outcomes. B7-H3 is expressed by antigen presenting cells, activated T cells, and a few normal tissues, including placenta and prostate. Expression of B7-H3 is seen in several cancer types, including prostate, breast, colon, lung, and gastric cancers, and in endothelial cells from tumor associated vasculature.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~48kDa

Notes: For research use only, not for use in diagnostic procedure.

CD276 Recombinant Protein - NCP0197

Item no : 80380494822
sold recently : Login >>
US$ 525.41
Pay in 4 interest-free payments of $131.35 Learn more
Min. order: 1piece

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jun 25 - Jun 30

Enjoy 20% off shipping

US$ 525.41

1-11

US$ 472.87

12-35

US$ 367.79

36-59

US$ 315.25

60+

US$40

Get now

Sign up to your membership to get coupons up to

15%

Get now

Opportunity to enjoy order discount up to 15% off

Please add the products
Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

recommand products

Camera 4
Camera 4

US$ 40.00

Min. order: 1 piece

5.0 (89 reviews)

Sold : Login>>

Calista
Calista

US$ 389.00

Min. order: 1 piece

4.9 (159 reviews)

Sold : Login>>

Related Searches